View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1347_high_1 (Length: 368)
Name: NF1347_high_1
Description: NF1347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1347_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 335; Significance: 0; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 29690454 - 29690116
Alignment:
| Q |
1 |
tagatcgatcttcggtccgtttcgccgctgctaaattttccggtgaagatttcaaggaacaagttcttatcgctttcattggcagggtatgagagcagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690454 |
tagatcgatcttcggtccgtttcgccgctgctaaattttccggtgaagatttcagggaacaagttcttatcgctttcattggcagggtatgagagcagcc |
29690355 |
T |
|
| Q |
101 |
ggttctcgtgattagtttcgacggtggtaaattttccggtaatgatttcagggaaaaggttcttttcgttttcattggcagggtatgagcgcagctggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690354 |
ggttctcgtgattagtttcgacggtggtaaattttccggtaatgatttcagggaaaaggttcttttcgttttcattggcagggtatgagcgcagctggtt |
29690255 |
T |
|
| Q |
201 |
ctcttggtcagtttcgacggtggtaagttttccgatgaagatttcagataacaaattcttttccttttcatgggcagggtgtgagagcagcaggttctca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690254 |
ctcttggtcagtttcgacggtggtaagttttccgatgaagatttcagataacaaattcttttccttttcatgggcagggtgtgagagcagcaggttctca |
29690155 |
T |
|
| Q |
301 |
tggtagatcgatcgatcttcactgatcgatggttggttt |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690154 |
tggtagatcgatcgatcttcactgatcgatggttggttt |
29690116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 29717966 - 29717628
Alignment:
| Q |
1 |
tagatcgatcttcggtccgtttcgccgctgctaaattttccggtgaagatttcaaggaacaagttcttatcgctttcattggcagggtatgagagcagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29717966 |
tagatcgatcttcggtccgtttcgccgctgctaaattttccggtgaagatttcagggaacaagttcttatcgctttcattggcagggtatgagagcagcc |
29717867 |
T |
|
| Q |
101 |
ggttctcgtgattagtttcgacggtggtaaattttccggtaatgatttcagggaaaaggttcttttcgttttcattggcagggtatgagcgcagctggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29717866 |
ggttctcgtgattagtttcgacggtggtaaattttccggtaatgatttcagggaaaaggttcttttcgttttcattggcagggtatgagcgcagctggtt |
29717767 |
T |
|
| Q |
201 |
ctcttggtcagtttcgacggtggtaagttttccgatgaagatttcagataacaaattcttttccttttcatgggcagggtgtgagagcagcaggttctca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29717766 |
ctcttggtcagtttcgacggtggtaagttttccgatgaagatttcagataacaaattcttttccttttcatgggcagggtgtgagagcagcaggttctca |
29717667 |
T |
|
| Q |
301 |
tggtagatcgatcgatcttcactgatcgatggttggttt |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29717666 |
tggtagatcgatcgatcttcactgatcgatggttggttt |
29717628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 259 - 339
Target Start/End: Original strand, 30828187 - 30828267
Alignment:
| Q |
259 |
ttttccttttcatgggcagggtgtgagagcagcaggttctcatggtagatcgatcgatcttcactgatcgatggttggttt |
339 |
Q |
| |
|
||||||||||||| | ||||| |||| | ||| | |||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
30828187 |
ttttccttttcattgctagggtttgagcgtagccagatctcatggtagatcgatcgatcttcattgatagatggttggttt |
30828267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University