View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1347_low_3 (Length: 331)
Name: NF1347_low_3
Description: NF1347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1347_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 97 - 329
Target Start/End: Original strand, 408569 - 408801
Alignment:
| Q |
97 |
gcaaagtactcactaagtgtagtagttagaaattaggaagcagtgttcacagatgtgtgatcagattaagagggccagcaaattttgggaaatttggatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408569 |
gcaaagtactcactaagtgtagtagttagaaattaggaagcagtgttcacagatgtgtgatcagattaagagggccagcaaattttgggaaatttggatg |
408668 |
T |
 |
| Q |
197 |
aaaaccagtgtcacacttgccttcatcttgtaacttcttaatgatactttataactttttatgtaatagacgtaaattttcccaaactctttgtaacttt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
408669 |
aaaaccagtgtcacacttgccttcatcttgtaacttcttaatgatactttataactttttatgtaatagacgtaaattttctcaaactctttgtaacttt |
408768 |
T |
 |
| Q |
297 |
ttgaagagttgaaactttagggatagtttcaaa |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
408769 |
ttgaagagttgaaactttagggatagtttcaaa |
408801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University