View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1347_low_4 (Length: 319)
Name: NF1347_low_4
Description: NF1347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1347_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 99 - 284
Target Start/End: Original strand, 2223015 - 2223200
Alignment:
| Q |
99 |
ttttgttgtgttgaagaatatcatcattttcttccatttcatctttggagtagttgttgtaattggttctaatgattttgattccttttttgtacttccc |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | || ||| |
|
|
| T |
2223015 |
ttttgttgtgttgaagaaaatcatcattttcttccatttcatctttggagtagtagttgcaattggttctaatgattttgattcctttttggaaccaccc |
2223114 |
T |
 |
| Q |
199 |
catttcttgtttgtgtttttgtgaatctccatgaaatggttcaacttgcttgtggttttgtgtgtttcaataaggttggtatcttt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2223115 |
catttcttgtttgtgtttttgtgaatctccatgaaatggttcaacttgtttgtgtttttgtgtgtttcaataaggttggtatcttt |
2223200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University