View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1347_low_5 (Length: 307)
Name: NF1347_low_5
Description: NF1347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1347_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 86 - 280
Target Start/End: Original strand, 30293429 - 30293624
Alignment:
| Q |
86 |
atattgagcatgtttagtaacatcttgagaattatttagtgaagtctaccggttgaattaacatactgnnnnnnnnnnnggattatttcgttatttatgt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30293429 |
atattgagcatgtttagtaacatcttgagaattatttagtgaagtctactggttgaattaacatactgttttttt----ggattatttcgttatttatgt |
30293524 |
T |
 |
| Q |
186 |
tgtcatgctttccacacattcaacttgctcttttgttagccacatca----cgttcatgtacgatgattaatttctctttttatat-aactttgtctctg |
280 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
30293525 |
tgccatgctttccacacattcaacttgctcttttgttacccacatcacgttcgttcatgtacgatgattgatttctctttttatataaactttgtctctg |
30293624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University