View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1347_low_6 (Length: 262)
Name: NF1347_low_6
Description: NF1347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1347_low_6 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 29690679 - 29690940
Alignment:
| Q |
1 |
aggttcaccaacctcacttccctcgacctctcccgctacaactatttaccgaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690679 |
aggttcaccaacctcacttccctcgacctctcccgctacaactatttaccgaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacat |
29690778 |
T |
|
| Q |
101 |
cactcaaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690779 |
cactcaaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttc |
29690878 |
T |
|
| Q |
201 |
ttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaacacctcgacc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690879 |
ttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaacacctcgacc |
29690940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 29718191 - 29718452
Alignment:
| Q |
1 |
aggttcaccaacctcacttccctcgacctctcccgctacaactatttaccgaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718191 |
aggttcaccaacctcacttccctcgacctctcccgctacaactatttaccgaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcacat |
29718290 |
T |
|
| Q |
101 |
cactcaaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718291 |
cactcaaactccctgtccctaccccctttccagcagatggcttgctcgcattctgccaaaccgttacaacattgacctctctcacttgttcccgtgcttc |
29718390 |
T |
|
| Q |
201 |
ttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaacacctcgacc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718391 |
ttttgttcacagccagctcttacccgttgctcattgtttccctttgctcaaacacctcgacc |
29718452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 30827992 - 30827877
Alignment:
| Q |
1 |
aggttcaccaacctcacttccctcgacctctcccgcta--caactatttaccgaacgatcttctctgcaaaatatctaacttcccattgaaaaaactcac |
98 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| ||| ||| ||| || |||| |||||| |||||| ||||| |||||||||||| ||||||| |
|
|
| T |
30827992 |
aggttcaccaatctcacctccctcgacctctcccactatacaagtatccactcgacgaacttctcatcaaaatctctaatttcccattgaaacaactcac |
30827893 |
T |
|
| Q |
99 |
atcactcaaactccct |
114 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30827892 |
atcactcaaactccct |
30827877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University