View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1347_low_8 (Length: 219)
Name: NF1347_low_8
Description: NF1347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1347_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 114 - 219
Target Start/End: Original strand, 5816019 - 5816124
Alignment:
| Q |
114 |
caacaccaaaatcaacacgtaatatccacataacattagagaccgagaaataggaacttgatgtcatctattcaattttagttcactaattattaccatt |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5816019 |
caacaccaaaatcaacatgtaatatccacataacattagagatcgagaaataggaacttgatgtcatctattcaattttagttcactaattattaccatt |
5816118 |
T |
 |
| Q |
214 |
tagtaa |
219 |
Q |
| |
|
|||||| |
|
|
| T |
5816119 |
tagtaa |
5816124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University