View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348-INSERTION-3 (Length: 214)
Name: NF1348-INSERTION-3
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348-INSERTION-3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 8 - 212
Target Start/End: Complemental strand, 44559815 - 44559611
Alignment:
| Q |
8 |
tggactagtattagtcattctgagtcggtgatgtgcgatcagttaatgtctggagaaaacaaatcacaaatgacaggtggcaacattattttagctgatt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559815 |
tggactagtattagtcattctgagtcggtgatgtgcgatcagttaatgtttggagaaaacaaatcacaaatgacaggtggcaacattattttagctgatt |
44559716 |
T |
|
| Q |
108 |
gcatggtgcaagttcacgatgacattagaaaatggataatctctgatttggtcggtatggagatggcaattggaaggtgaatattttgatggtgtagatg |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559715 |
gcatggtgcaagttcacgatgacatgagaaaatggatagtctctgatttggtcgatatggagatggcaattggaaggtgaatattttgatggtgtagatg |
44559616 |
T |
|
| Q |
208 |
tgaga |
212 |
Q |
| |
|
||||| |
|
|
| T |
44559615 |
tgaga |
44559611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University