View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348-INSERTION-4 (Length: 442)
Name: NF1348-INSERTION-4
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348-INSERTION-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 149 - 389
Target Start/End: Original strand, 33881313 - 33881553
Alignment:
| Q |
149 |
aagaagagagagagaatgcggtagaagctaagaagcgagcatggcgttgagcgtcgaggcgattctgtgcttgacggagtagagattgttgtctgcgtcg |
248 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33881313 |
aagaagagagagagaatgcggtggaaactaagaagcgagcatggtgttgagcgtcgaggcgattctgtgcttgacggagtagagattgttgtctgcgtcg |
33881412 |
T |
|
| Q |
249 |
ctcttgatcggagattaagggacgtttgaatggacggcggagatcgtgcggcgccatgggaagtatctatctgagagagaattgtaatgcaaacagagtt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33881413 |
ctcttgatcggagattaagggacgtttgaatggacggcggagatcgtgcggcgccatgggaagtatctatctgagagagaattgtaatgcaaacagagtt |
33881512 |
T |
|
| Q |
349 |
gagtttgagttccttcaattcaacgcgcgtccttttgaatg |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33881513 |
gagtttgagttccttcaattcaacgcgcgtccttttgaatg |
33881553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 33881190 - 33881268
Alignment:
| Q |
8 |
gtttggcgaaccattttcgagcttctgcgcctttcagcttcgaagcttctagaacatcgagttcgtcattctgatgtga |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33881190 |
gtttggcgaaccattttcgagcttctgcgcctttcagcttcgaagcttctagaacatcgagttcgtcattctgatgtga |
33881268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University