View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13480_high_10 (Length: 232)
Name: NF13480_high_10
Description: NF13480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13480_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 47812738 - 47812933
Alignment:
| Q |
20 |
ggattgacggtgagtttgacaaaatgacaatgatatcagctttttgtagaagctcaagcataatcatctgtctatttgattaatcattaatgtgtatttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47812738 |
ggattgacggtgagtttgacaaaatgacaatgatatcagctttttgtagaagctcaagcataatcatctgtctatttgattaatcattaatgtgtatttg |
47812837 |
T |
 |
| Q |
120 |
atgctgaaagcacattctcttctaatgaacaagtttattcacttcccatacgagcttgtagaggggaaacacctcgttaccaataaactgcatatt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47812838 |
atgctgaaagcacattctcttctaatgaacaagtttattcacttcccatacgagcttgtagaggggaaacacctcgttaccaatacactgcatatt |
47812933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University