View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13480_low_11 (Length: 232)

Name: NF13480_low_11
Description: NF13480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13480_low_11
NF13480_low_11
[»] chr4 (1 HSPs)
chr4 (19-214)||(2325848-2326043)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 2326043 - 2325848
Alignment:
19 cagagggttcagttgatgtttgcttgaagagtaacctgaaagttgtacggagaaagtgatagtggaaaggacaatcacagtactcataattcataaacat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2326043 cagagggttcagttgatgtttgcttgaagagtaacctgaaagttgtacggagaaagtgatagtggaaaggacaatcacagtactcataattcataaacat 2325944  T
119 aaataaactgtttcagcaatgcaatatctttcccatgctagcagtacttccacatgc-----aagatgaaactgtttcagataaatactattactatcaa 213  Q
    |||||||||||||||     | ||||||||||||||||| |||||||||||||||||     ||||||||||||||||||||||||||||||||||||||    
2325943 aaataaactgtttca-----gtaatatctttcccatgcttgcagtacttccacatgcaagctaagatgaaactgtttcagataaatactattactatcaa 2325849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University