View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13480_low_11 (Length: 232)
Name: NF13480_low_11
Description: NF13480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13480_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 214
Target Start/End: Complemental strand, 2326043 - 2325848
Alignment:
| Q |
19 |
cagagggttcagttgatgtttgcttgaagagtaacctgaaagttgtacggagaaagtgatagtggaaaggacaatcacagtactcataattcataaacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2326043 |
cagagggttcagttgatgtttgcttgaagagtaacctgaaagttgtacggagaaagtgatagtggaaaggacaatcacagtactcataattcataaacat |
2325944 |
T |
 |
| Q |
119 |
aaataaactgtttcagcaatgcaatatctttcccatgctagcagtacttccacatgc-----aagatgaaactgtttcagataaatactattactatcaa |
213 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2325943 |
aaataaactgtttca-----gtaatatctttcccatgcttgcagtacttccacatgcaagctaagatgaaactgtttcagataaatactattactatcaa |
2325849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University