View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13481_low_5 (Length: 484)
Name: NF13481_low_5
Description: NF13481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13481_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 42 - 450
Target Start/End: Complemental strand, 52585026 - 52584618
Alignment:
| Q |
42 |
ggatttgattgtgaccactgattatgctcaccaatgaatccactgctcaacctcaatagggcttcgtgcacctagtacggattcaccacttctatgttaa |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52585026 |
ggatttgattgtgaccactgattatgctcaccaatgaatccactgctcaacctcaatagggcttcgtgcacctagtacggattcaccacttctatgttaa |
52584927 |
T |
|
| Q |
142 |
tgtcttattaactcatgtcttcagaatatatactatactagcttttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584926 |
tgtcttattaactcatgtcttcagaatatatactatactagcttttttgctcaaatagtttcttcagtacgtaaaaaacagtgttgattcgattcgattc |
52584827 |
T |
|
| Q |
242 |
gattccccctttcactccttttctctttttccataaaaatctctcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttc |
341 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584826 |
gattccccctttcactccttttctccttttccataaaaatctctcttctttcactgttctagagagatccacatcacaaaactcacatgcttcatttttc |
52584727 |
T |
|
| Q |
342 |
caattgagttgttcccttaagggacacaatacaatacaagtatagaactagtttattttttcaatcactttctctcagacnnnnnnngctagctacaatt |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52584726 |
caattgagttgttcccttaagggacacaatacaatacaagtatagaactagtttatttattcaatcactttctctcagacaaaaaaagctagctacaatt |
52584627 |
T |
|
| Q |
442 |
gatgatgtc |
450 |
Q |
| |
|
|||||||| |
|
|
| T |
52584626 |
aatgatgtc |
52584618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University