View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13482_high_2 (Length: 255)
Name: NF13482_high_2
Description: NF13482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13482_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 3 - 243
Target Start/End: Original strand, 21937164 - 21937404
Alignment:
| Q |
3 |
attttaacgtttctacatgtctaaaactcgagtttgaatttaaaatctttgttaagttagaagagattagagtaagaaaaataatttttccacacaatac |
102 |
Q |
| |
|
|||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
21937164 |
attttaacgtttctacatgtttaaaattcaagtttgaatttaaaatctttgttaagttataagagattagagtaaggaaaatattttttccacacaatac |
21937263 |
T |
 |
| Q |
103 |
aacgtcaacatcatttatttagagcttgtttgacaaagtcaattttcgaacttataacacatatttataactcataaaacaaaaatagatttatttgact |
202 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21937264 |
aacgtcaacatcatatatttagaggttgtttgagaaagttaattttcgagcttataacacatatttataactcataaaacaaaaatagatttatttgact |
21937363 |
T |
 |
| Q |
203 |
tattagctcatatgtcccgtttcgcgtgtccaaataatatt |
243 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21937364 |
tattagctcatatgtcccgtttcgtgtgtccaaataatatt |
21937404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University