View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13482_high_4 (Length: 239)
Name: NF13482_high_4
Description: NF13482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13482_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 16193664 - 16193881
Alignment:
| Q |
1 |
actttttgcttttgaagttcaagtaccaatggttttaaccttttttcagaagcacggtttgttggtatatttttctactttagtggtttcttatgtgtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16193664 |
actttttgcttttgaagttcaagtaccaatggttttaaccttttttcagaagcacggtttgttggcatatttttctactttagtggtttcttatgtgtct |
16193763 |
T |
 |
| Q |
101 |
gtactttatagttcttgaaatttatgttcatttttggtctaattgaaattggttattacatccctgttttttacagacaccacataatctcctttagttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16193764 |
gtactttatagttcttgaaatttatgttcatttttggtctaattgaaattgg---ttacatccctgttttttacagacaccacataatctcctttatttt |
16193860 |
T |
 |
| Q |
201 |
taattttcttaaagagaaagg |
221 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
16193861 |
tacctttcttaaagagaaagg |
16193881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University