View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13482_low_1 (Length: 266)
Name: NF13482_low_1
Description: NF13482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13482_low_1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 21936884 - 21937129
Alignment:
| Q |
19 |
atgtgtctcttaaatttatggatgacaagtaatgaag-cattatggatcataatatgtagcctgccactatcaccgactcaattcattcatttttcccgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21936884 |
atgtgtctcttaaatttatggatgacaagcaatgaaggcattatggatcataatatgtagcctgccactatcaccgactcaattcattcatttttcccgt |
21936983 |
T |
|
| Q |
118 |
aagaaatgggggagtcatatgtttgttgagatgtcatggtgtaccataaatgctcttttttcattattcattttcccaagtgaagatgatttcataacca |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21936984 |
aagaaatgggggattcatatgtttgttgagatgtcatggtgtaccataaatgctcttttttcattattcattttcccaagtgaagatgatttcataacca |
21937083 |
T |
|
| Q |
218 |
cttgcgtactagtacttttgtgtgtaaacaatacgaacgcttgaagatt |
266 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21937084 |
cttgcgtac---tacttttgtgtgtaaataatacgaacgcttgaagatt |
21937129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University