View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13482_low_4 (Length: 239)

Name: NF13482_low_4
Description: NF13482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13482_low_4
NF13482_low_4
[»] chr1 (1 HSPs)
chr1 (1-221)||(16193664-16193881)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 16193664 - 16193881
Alignment:
1 actttttgcttttgaagttcaagtaccaatggttttaaccttttttcagaagcacggtttgttggtatatttttctactttagtggtttcttatgtgtct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
16193664 actttttgcttttgaagttcaagtaccaatggttttaaccttttttcagaagcacggtttgttggcatatttttctactttagtggtttcttatgtgtct 16193763  T
101 gtactttatagttcttgaaatttatgttcatttttggtctaattgaaattggttattacatccctgttttttacagacaccacataatctcctttagttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||| |||    
16193764 gtactttatagttcttgaaatttatgttcatttttggtctaattgaaattgg---ttacatccctgttttttacagacaccacataatctcctttatttt 16193860  T
201 taattttcttaaagagaaagg 221  Q
    ||  |||||||||||||||||    
16193861 tacctttcttaaagagaaagg 16193881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University