View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13483_low_2 (Length: 288)
Name: NF13483_low_2
Description: NF13483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13483_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 22 - 275
Target Start/End: Original strand, 14180721 - 14180975
Alignment:
| Q |
22 |
ccgcaccgacatatgtggt-acatacattcaataattccatgttctgaaannnnnnnnggttggtatcgatgtatcaatgtcagtgatgtgtgcagtatt |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14180721 |
ccgcaccgacatatgtggttacatacattcaataattccatgttctgaaattattattggttggtatcgatgtatcaatgtcagtgatgtgtgcagtatt |
14180820 |
T |
 |
| Q |
121 |
cgtgtatgtgtcagtatttcatagatcacagatgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaaac |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14180821 |
cgtgtatgtgtcggtatttcatagatcacagctgttgctccatccatgtgtctctaggagcttttctaacgccgaaatactctacaacgctttcagaaac |
14180920 |
T |
 |
| Q |
221 |
cccagcaacattactcaataatgaggctccccatgccagccaacctgtctgtgct |
275 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14180921 |
cccagcaacattactcaataatgaggttccccatgccagccaacctgtctgtgct |
14180975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University