View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13483_low_3 (Length: 276)
Name: NF13483_low_3
Description: NF13483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13483_low_3 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 93 - 276
Target Start/End: Original strand, 33602613 - 33602796
Alignment:
| Q |
93 |
gtcgttgtcttcttcatcaacaccggaagatcttggtgagattgtcgagttaccaagactaggaacatgttttgaatcactagaccctgagtgtgtgttt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
33602613 |
gtcgttgtcttcttcatcaacaccggaagatcttggtgagattgttgagttaccaagactaggaacatgttttgagtcacttgaccctgagtttgtgttt |
33602712 |
T |
|
| Q |
193 |
tttgacccagttgattattggtatcatagcaataataatagcatttatgataatgaagaagagaatggttatggttatggtgat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33602713 |
tttgacccagttgattattggtatcatagcaataataatagcatttatgataatgaagaagagaatggttatggttatggtgat |
33602796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University