View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13483_low_3 (Length: 276)

Name: NF13483_low_3
Description: NF13483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13483_low_3
NF13483_low_3
[»] chr6 (1 HSPs)
chr6 (93-276)||(33602613-33602796)


Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 93 - 276
Target Start/End: Original strand, 33602613 - 33602796
Alignment:
93 gtcgttgtcttcttcatcaacaccggaagatcttggtgagattgtcgagttaccaagactaggaacatgttttgaatcactagaccctgagtgtgtgttt 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||| |||||||    
33602613 gtcgttgtcttcttcatcaacaccggaagatcttggtgagattgttgagttaccaagactaggaacatgttttgagtcacttgaccctgagtttgtgttt 33602712  T
193 tttgacccagttgattattggtatcatagcaataataatagcatttatgataatgaagaagagaatggttatggttatggtgat 276  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33602713 tttgacccagttgattattggtatcatagcaataataatagcatttatgataatgaagaagagaatggttatggttatggtgat 33602796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University