View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13484_low_14 (Length: 219)
Name: NF13484_low_14
Description: NF13484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13484_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 42003036 - 42002844
Alignment:
| Q |
1 |
agaatttggaagagtgagtaagggttcactgaaggtggtg---------ttggtgcacgtgaggtcgaaacctgggtaactacaaagattggtttgattt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003036 |
agaatttggaagagtgagtaagggttcactgaaggtggtggtggtggtgttggtgcacgtgaggtcgaaacctgggtaactacaaagattggtttgattt |
42002937 |
T |
 |
| Q |
92 |
gattggtttaatgaaaacggaaaccaaattggaagtccgtaggtttcgcatgatgttgtcctttcacaagtgaagaacttttcaccttttgtt |
184 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
42002936 |
gattggtttaatgaaaacggaaaccgaattggaagtccgtaggtttcgcatgatgctgtcctttcacatgtgaagaactcttcaccttttgtt |
42002844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 177 - 205
Target Start/End: Original strand, 42003188 - 42003216
Alignment:
| Q |
177 |
cttttgttaatttttcattcctaaattgt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42003188 |
cttttgttaatttttcattcctaaattgt |
42003216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University