View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13486_low_9 (Length: 249)
Name: NF13486_low_9
Description: NF13486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13486_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 47729453 - 47729223
Alignment:
| Q |
1 |
ttcgcgactttgatattataaaaaattataatcaaatatagttagcatgactttgatactgcgaaaaatcatagtcaaatacagctaacgcaaccacgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47729453 |
ttcgcgactttgatattataaaaaattataatcaaatatagttagcatgactttgatactgcgaaaaatcatagtcaaatacagctaacgcaaccatgta |
47729354 |
T |
 |
| Q |
101 |
attgtgatgttgcaactactatagcggttgctgataacttttaaaacattggacatatatatatagttgcacctgcaattcgaaaccttgataacctact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47729353 |
attgtgatgttgcaactactatagcggttgctgataacttttaaaacattggacata----tatagttgcacctgcaattcgaaaccttgataacctact |
47729258 |
T |
 |
| Q |
201 |
atgattctttattactaacaagtccttgtattttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47729257 |
atgattctttattactaacaagtccttgtattttt |
47729223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University