View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13487_high_2 (Length: 206)
Name: NF13487_high_2
Description: NF13487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13487_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 159
Target Start/End: Complemental strand, 42236280 - 42236141
Alignment:
| Q |
20 |
ctatttgggtcttgtgatgaggatgatggagttgaggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataa |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236280 |
ctatttgggtcttgtgatgatgatgatggagttgaggttgatgttgaagtgtttcttagtctacgttcatcgtctagtttcttggctgtgatgagaataa |
42236181 |
T |
|
| Q |
120 |
gtgtttcttggattgtccaattacctttacggtattctct |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236180 |
gtgtttcttggattgtccaattacctttacggtattctct |
42236141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University