View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_high_35 (Length: 427)
Name: NF1348_high_35
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_high_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 30 - 419
Target Start/End: Original strand, 3842859 - 3843247
Alignment:
| Q |
30 |
gaggcaccggcggggggtgctgcagctggggaatagccaggaaatggaggagcggcttgaccagaaggaaaagtaccaggtgctgataaataactttgtg |
129 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3842859 |
gaggcaccggcggggggtactgcagctggggaatagccaggaaatggaggagcggcttgaccagaaggaaaagtaccgggtgctgataaataactttgtg |
3842958 |
T |
 |
| Q |
130 |
aaacttcctgctggtttggatcccatgatggcatttgtccctgtgaaccagaatacatagtcgcagcttgagtggtctgccatgcaggagcttgagctgc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3842959 |
taacttcctgctggtttggatcccatgatggcatttgtcccattgaaccagaatacatagtcgcagcttgagtggtctgccatgcaggagcttgagctgc |
3843058 |
T |
 |
| Q |
230 |
atggagactaggatctagcactgtatagtctctgcttttgtcactgaatgcctgaaaccaaaacaattatattaagtgaatatcattcgaagatcaaaag |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843059 |
atggagactaggatctagcactgtatagtctctgcttttgtcactgaatgcctgaaacc-aaacaattatattaagtgaatatcattcgaagatcaaaag |
3843157 |
T |
 |
| Q |
330 |
aaacactataaaaggtcaatcaagtgttgagaagcatacactcgagcattatttctgatcaagaaaatgtccaactttctcatattcttc |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843158 |
aaacactataaaaggtcaatcaagtgttgagaagcatacactcgagcattatttctgatcaagaaaatgtccaactttctcatattcttc |
3843247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 249 - 288
Target Start/End: Original strand, 2878965 - 2879004
Alignment:
| Q |
249 |
actgtatagtctctgcttttgtcactgaatgcctgaaacc |
288 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
2878965 |
actgtatagtctctacttttgtcactgaaagcctgaaacc |
2879004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University