View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_high_57 (Length: 311)
Name: NF1348_high_57
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_high_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 42 - 250
Target Start/End: Complemental strand, 6285223 - 6285013
Alignment:
| Q |
42 |
atcatcaaaacccttatcgcaagtagatgccatggctaaaggtagctaatagcacaataattaatgaagaggagaaaaagaatgatatactgcttttagt |
141 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6285223 |
atcagcaaaacccttatcgcaagtagatgccatggctaaaggtagctaatagcacaataattaatgaagaggagagaaagaatgatatactgcttttagc |
6285124 |
T |
 |
| Q |
142 |
ctatggttgagagtgtcttgactcttgactatagttaagtata--tatagctgtagagacacgtttatttttgttgtaactagttaattaatacgagtat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6285123 |
ctatggttgagagtgtcttgactcttgattatagttaagtatatatatagctgtagagacacgtttatttttgttgtaactagttaattaatacgagtat |
6285024 |
T |
 |
| Q |
240 |
attttgtcaca |
250 |
Q |
| |
|
||||||||||| |
|
|
| T |
6285023 |
attttgtcaca |
6285013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University