View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_high_79 (Length: 246)
Name: NF1348_high_79
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_high_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 1270822 - 1271044
Alignment:
| Q |
1 |
tccaactaaaatttatgtttgaggcagccacacattatgaagatttgtcaaatatcagctatagtggtgttatagcgatatagcagagcagaattttaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
1270822 |
tccaactaaaatttatgtttgaggcagccacacattatgaagatttgtcaaatatcagctatagtggtgttatagtgctatagcagagcagaattttaac |
1270921 |
T |
|
| Q |
101 |
aaaccgctattgttctactatacgataattagtattaaataatagttatagctgcattgttgcgtaacgaaatttaaataaaccactatttactggtgat |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1270922 |
aaaccgctattgttctattatacgataattagtattaaataatagttatagctgcattgttgcgtaacgaaatttaaataaaccactatttactggtgat |
1271021 |
T |
|
| Q |
201 |
ccgcggttgacaatattgatatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1271022 |
ccgcggttgacaatattgatatt |
1271044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 114
Target Start/End: Original strand, 12196906 - 12196946
Alignment:
| Q |
74 |
agcgatatagcagagcagaattttaacaaaccgctattgtt |
114 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12196906 |
agcgctatagcacagcaaaattttaacaaaccgctattgtt |
12196946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 114
Target Start/End: Original strand, 12441334 - 12441374
Alignment:
| Q |
74 |
agcgatatagcagagcagaattttaacaaaccgctattgtt |
114 |
Q |
| |
|
|||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12441334 |
agcgctatagcacagcaaaattttaacaaaccgctattgtt |
12441374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University