View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_100 (Length: 225)
Name: NF1348_low_100
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_100 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 45801203 - 45801397
Alignment:
| Q |
1 |
agcgaaattccggtgctcgaaagcgcgtgctgtacagaagcaggtatacgagtggtgtcaccataggcggagatggaaacgggaccacaatagttcatac |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801203 |
agcgaaattccggtgctagaaagcgcgtgctgtacagaagcaggtatacgagtggtgtcaccataggcggagatggaaacgggaccacaatagttcatac |
45801302 |
T |
|
| Q |
101 |
gaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatgacagttctctatatcccaccataccgatatcttc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45801303 |
gaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatgacagttctctatatcccaccataccgatatcttc |
45801397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University