View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1348_low_107 (Length: 201)

Name: NF1348_low_107
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1348_low_107
NF1348_low_107
[»] chr2 (1 HSPs)
chr2 (1-125)||(2664994-2665118)


Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 2665118 - 2664994
Alignment:
1 tcactggtaaccaaacactaatttcaccttcacaaaattttgaacttggtttctttacacctaaaaattccacttacacttatcttggaatatggtataa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2665118 tcactggtaaccaaacactaatttcaccttcacaaaattttgaacttggtttctttacacctaaaaattccacttacacttatcttggaatatggtataa 2665019  T
101 gcaaattcacataaagaatattgtt 125  Q
    |||||||||||||||||||||||||    
2665018 gcaaattcacataaagaatattgtt 2664994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University