View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_49 (Length: 376)
Name: NF1348_low_49
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 17 - 303
Target Start/End: Original strand, 44559611 - 44559897
Alignment:
| Q |
17 |
tctcacatctacaccatcaaaatattcaccttccaattgccatctccataccgaccaaatcagagattatccattttctaatgtcatcgtgaacttgcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
44559611 |
tctcacatctacaccatcaaaatattcaccttccaattgccatctccatatcgaccaaatcagagactatccattttctcatgtcatcgtgaacttgcac |
44559710 |
T |
|
| Q |
117 |
catgcaatcagctaaaataatgttgccacctgtcatttgtgatttgttttctccagacattaactgatcgcacatcaccgactcagaatgactaatacta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559711 |
catgcaatcagctaaaataatgttgccacctgtcatttgtgatttgttttctccaaacattaactgatcgcacatcaccgactcagaatgactaatacta |
44559810 |
T |
|
| Q |
217 |
gtccaagtgctaaccattactttgcaaataaataatctgagggtttagcaacaatgcctctcctcaagtatccctcggctatatttt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559811 |
gtccaagtgctaaccattactttgcaaataaataatctgagggtttagcaacaatgcctctcctcaagtatccctcggctatatttt |
44559897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University