View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_53 (Length: 356)
Name: NF1348_low_53
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 78 - 280
Target Start/End: Complemental strand, 42658631 - 42658429
Alignment:
| Q |
78 |
tgtcgtggttatcgtcgagaaagatggtgttgcctgcttcattcattgatgagaggataaggaattgtggttgaaaaccaaatatgagaaggttgcaagg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658631 |
tgtcgtggttatcgtcgagaaagatggtgttgcctgcttcattcattgatgagaggataaggaattgtggttgaaaaccaaatatgagaaggttgcaagg |
42658532 |
T |
 |
| Q |
178 |
tgatttaagagcaattaaatttgataaaactttgaattctttctctttgaaagtggttgtaatgttggaggattcatgtgtatctgatgcaataatattg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
42658531 |
tgatttaagagcaattaaatttgataaaactttgaattctttctctttgaaagtggttgtaatgttggaggattcatgtgtatgtgatgcaataattttg |
42658432 |
T |
 |
| Q |
278 |
ttg |
280 |
Q |
| |
|
||| |
|
|
| T |
42658431 |
ttg |
42658429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University