View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_69 (Length: 296)
Name: NF1348_low_69
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_69 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 155 - 291
Target Start/End: Original strand, 30967957 - 30968092
Alignment:
| Q |
155 |
aagtatagttctaatagtgtcccatctggctacaggagcaaaaaacttcattgtaatcaactccatacttttgagagtacccctttgctactaatctggc |
254 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30967957 |
aagtatagttctattagtgtcccatctggttacaggagcaaaa-acttcattgtaatcaactccatacttttgagagtacccctttgctactaatctggc |
30968055 |
T |
|
| Q |
255 |
tttgtgtttttcaactttaccattttcattgtatttt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30968056 |
tttgtgtttttcaactttaccattttcattgtatttt |
30968092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 259
Target Start/End: Complemental strand, 608565 - 608466
Alignment:
| Q |
159 |
atagttctaatagtgtcccatctggctacaggagcaaaaaacttcattgtaatcaactccatacttttgagagtacccctttgctactaatctggctttg |
258 |
Q |
| |
|
|||||||| |||||||||||||| || || ||||| ||| |||||||| || | || ||||||| |||||||| || || ||||||| |||||||||| |
|
|
| T |
608565 |
atagttcttatagtgtcccatcttgcaactggagc-aaacacttcattatagttaataccatactgctgagagtagcctttagctactagtctggctttg |
608467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University