View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_71 (Length: 288)
Name: NF1348_low_71
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_71 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 14 - 288
Target Start/End: Complemental strand, 35074914 - 35074640
Alignment:
| Q |
14 |
agagctgcacaatattcagatttcttgggtataatttttctcgatcaattcttccactcttataagggctatgaagaagcccttggggggtgcctcattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074914 |
agagctgcacaatattcagatttcttgggtataatttttctcgatcaattcttccactcttataagggctatgaagaagcccttggggggtgcctcattt |
35074815 |
T |
 |
| Q |
114 |
atcaattttggctaccggcaatcaggtgaatgaagggaatctgcaaacactggaggtttagatgtggaacttgactgtgtttgtgaggtcatgccattga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074814 |
atcaattttggctaccggcaatcaggtgaatgaagggaatctgcaaacactggaggtttagatgtggaacttgactgtgtttgtgaggtcatgccattga |
35074715 |
T |
 |
| Q |
214 |
agaatgttgaagtgccttcattggcttgccacctttgtagtgcttgagtaagactcatctgattgttatccgcac |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35074714 |
agaatgttgaagtgccttcattggcttgccacctttgtagtgcttgagtaagactcatctgattgtcatccgcac |
35074640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 222 - 271
Target Start/End: Original strand, 38158604 - 38158653
Alignment:
| Q |
222 |
gaagtgccttcattggcttgccacctttgtagtgcttgagtaagactcat |
271 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||| ||| ||||| |
|
|
| T |
38158604 |
gaagtgccttcattggcttgccatctttgtagagcttgaggaaggctcat |
38158653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University