View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_72 (Length: 285)
Name: NF1348_low_72
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 275
Target Start/End: Original strand, 24425413 - 24425673
Alignment:
| Q |
29 |
acttttggctatgtttttgtccaaaattagatgttgaattgttgatattgatacaattatgaacttttgactttgtttttgatagaattagatgttgtcc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24425413 |
acttttggctatgtttttgtccaaaattagatgttgaattgttgatattgatacaattatgaacttttgactttgtttttgatagaattagatgttgtcc |
24425512 |
T |
 |
| Q |
129 |
aaaattaggtacaggcagtatcaccagggtcatttgtgcctcaagctccgtacagaaacgcttgggcgcaataat--------------gtcaattgcgc |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
24425513 |
aaaactaggtacaggcagtatcaccagggtcatttgcgcctcaagctccgtacagaaacgcttgggtgcaataatgtcagaagcccatagtcaattgcgc |
24425612 |
T |
 |
| Q |
215 |
ctgaagcactagaaaataccacttgggcgatgacattgcaatagtcctagagttatctgtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||| |
|
|
| T |
24425613 |
ctgaagcactagaaaataccacttgggcgctgacattgcagtagtcctagagttatttgtg |
24425673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University