View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_76 (Length: 272)
Name: NF1348_low_76
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 117 - 241
Target Start/End: Complemental strand, 32069778 - 32069653
Alignment:
| Q |
117 |
caacaacaacagaaatactcaatctctgtcgtgnnnnnnn-gccaaaataatatgagaaagtggaaattcagtctctttctatggcttgcatcgttttgt |
215 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32069778 |
caacaacaacaaaaatactcaatctctgtcgtgttttttttgccaaaataatatgagaaagtggaaattcagtctctttctatggcttgcatcgttttgt |
32069679 |
T |
 |
| Q |
216 |
tttttgttacagtgttttggtctgtg |
241 |
Q |
| |
|
||||||| ||||||||||||| |||| |
|
|
| T |
32069678 |
tttttgtcacagtgttttggtttgtg |
32069653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University