View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_77 (Length: 270)
Name: NF1348_low_77
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 60 - 242
Target Start/End: Complemental strand, 52630789 - 52630607
Alignment:
| Q |
60 |
ggatgaaaggagtggtgattgaaatgggaaaagggggtgtaggaattaagggtcctctaatttgggagaaagaaatgtatgtggatgtttggggtggtga |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630789 |
ggatgaaaggagtggtgattgaaatgggaaaaggaggtgtaggaattaagggtcctctagtttgggagaaagaaatgtatgtggatgtttggggtggtga |
52630690 |
T |
 |
| Q |
160 |
attatggatacatgttctgaagtcaacattggagtatgggttagcacctatgtcttggactgattacttgtatttgtctgtgg |
242 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52630689 |
attatggatacatgttctgaaggcaacattggagtatgggttagcacctatgtcttggactgattacttgtatttgtctgtgg |
52630607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 212 - 240
Target Start/End: Original strand, 17243437 - 17243465
Alignment:
| Q |
212 |
tcttggactgattacttgtatttgtctgt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17243437 |
tcttggactgattacttgtatttgtctgt |
17243465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University