View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1348_low_86 (Length: 253)
Name: NF1348_low_86
Description: NF1348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1348_low_86 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 22534222 - 22534061
Alignment:
| Q |
1 |
aatcatcccaactgaaatcagttcttaatatatcggatattgttctcgtggcagggttccagaagcggcacaatactcttcgaaatttagtaccctcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22534222 |
aatcatcccaactgaaatcagttcttaatatatcagatattgttctcgtggcggggttccagaagcggcacaatactcttcgaaatttagtaccctcatc |
22534123 |
T |
 |
| Q |
101 |
atgatcataaccgcgcaagaaaagcaatccattgcatgaaccaagaatattgggaactacgt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22534122 |
atgatcataaccgcgcaagaaaagcaatccattgcatgaaccaagaatattgggaactacgt |
22534061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 14 - 160
Target Start/End: Original strand, 22525657 - 22525803
Alignment:
| Q |
14 |
gaaatcagttcttaatatatcggatattgttctcgtggcagggttccagaagcggcacaatactcttcgaaatttagtaccctcatcatgatcataaccg |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||| ||||||||||| |||||| || |||||||||||||||| ||||| |||||||| |
|
|
| T |
22525657 |
gaaatcagttctcaatatatcggatattgttctcgtagcggggtttcagaagcggcataatacttttttaaatttagtaccctcaccatgaccataaccg |
22525756 |
T |
 |
| Q |
114 |
cgcaagaaaagcaatccattgcatgaaccaagaatattgggaactac |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22525757 |
cgcaagaaaagcaatccattgcatgaaccaagaataatgggaactac |
22525803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University