View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13490_high_18 (Length: 306)
Name: NF13490_high_18
Description: NF13490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13490_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 281
Target Start/End: Original strand, 38096708 - 38096967
Alignment:
| Q |
14 |
gaacctgtgctcaagaaatctaattcctataatgaagaaaggtacgtttctcattaattacttatagaatttcttttatttgttgtttaatttgttacct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
38096708 |
gaacctgtgctcaagaaatctaattcctataatgaagaaaggtacgtttctcatta----cttttagaatttcttttatttgttgtttaaat-gttacct |
38096802 |
T |
|
| Q |
114 |
tttgttttcttacaggagaagcaggctagggatggatgaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaannnnnnnnagtgaaagag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38096803 |
tttgttttcttacaggagaagcaggctagggatggatgaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaa---gggggagtgaaagag |
38096899 |
T |
|
| Q |
214 |
aaatgcataccgcttatgaaatcatccaaagagagtaggaaatgatggtgatctggtctggtctggtc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38096900 |
aaatgcataccgcttatgaaatcatccaaagagagtaggaaatgatggtgatctggtatggtctggtc |
38096967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University