View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13491_low_5 (Length: 254)
Name: NF13491_low_5
Description: NF13491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13491_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 29333810 - 29334033
Alignment:
| Q |
1 |
cggtggcggtttttggagggaaaagtgaatttcagtttcattctgttatggcggcgttccacgtcagcttttctgttgaattttagaagaaagacagtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29333810 |
cggtggcggtttttggagggaaaagtgaatttcagtttcattctgttatggcggcgttccacgtcagcttttctgttgaattttagaagaaagacagtgg |
29333909 |
T |
 |
| Q |
101 |
cagtattgtaatttgtgaagaagggtttttctcttattatatagggttaatgggggttaatgtagtggcagtaaaaacccgttactcagttctgtctggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
29333910 |
cagtattgtaatttgtgaagaagggtttttctcttattatata----------gggttaatgtagtggcagtaaaaacccgt---tcagttctgtctagt |
29333996 |
T |
 |
| Q |
201 |
caaagttgttatttgcgactagttacttgagctcttc |
237 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||| |
|
|
| T |
29333997 |
caaagttgttatttgcgggtggttacttgagctcttc |
29334033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University