View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13492_high_10 (Length: 319)
Name: NF13492_high_10
Description: NF13492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13492_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 12 - 300
Target Start/End: Complemental strand, 45868227 - 45867939
Alignment:
| Q |
12 |
atgaaacctgtgtgagatgttgggatctttgagtagcttcggcattgagcttggtggatgcttccctgaaacaacgagatttaatttaaatttaatcaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868227 |
atgaaacctgtgtgagatgttgggatctttgagtagcttcagcattgagcttggtggatgcttccctgaaacaacgagatttaatttaaatttaatcaat |
45868128 |
T |
 |
| Q |
112 |
ttggtataacagcaattaaaatttgaaagaagaagaagaagcgaaaggggttactggaagtagaaatcgaaagtatcgaggacgaaatcatcaacagtgt |
211 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868127 |
ttggtataacaacaattaaaatttgaaagaagaagaagaagcgaaaggggttactggaagtagaaatcgaaagtatcgaggacgaaatcatcaacagtgt |
45868028 |
T |
 |
| Q |
212 |
tgagaacttcgttgaagaagagttgtggattcagattcatcaccgattcgaaaatcacatcgctctcgctgctcatgcttccttccatt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45868027 |
tgagaacttcgttgaagaagagttgtggattcaaattcatcaccgattcgaaaatcgcatcgctctcgctgctcatgcttccttccatt |
45867939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 161 - 265
Target Start/End: Original strand, 45982929 - 45983033
Alignment:
| Q |
161 |
gttactggaagtagaaatcgaaagtatcgaggacgaaatcatcaacagtgttgagaacttcgttgaagaagagttgtggattcagattcatcaccgattc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45982929 |
gttactggaagtagaaatcgaaagtatcgatgaagaaatcgtcaacggtgttgagaacttcgttgaagaagagttgtggattcagattcatcaccgattc |
45983028 |
T |
 |
| Q |
261 |
gaaaa |
265 |
Q |
| |
|
|||| |
|
|
| T |
45983029 |
aaaaa |
45983033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 12 - 84
Target Start/End: Original strand, 45982778 - 45982850
Alignment:
| Q |
12 |
atgaaacctgtgtgagatgttgggatctttgagtagcttcggcattgagcttggtggatgcttccctgaaaca |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45982778 |
atgaaacctgtgtgagatgttgggatctttgagtagcttcagcattgagcttggtggatgcttccctgaaaca |
45982850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 15 - 86
Target Start/End: Complemental strand, 40892910 - 40892839
Alignment:
| Q |
15 |
aaacctgtgtgagatgttgggatctttgagtagcttcggcattgagcttggtggatgcttccctgaaacaac |
86 |
Q |
| |
|
|||||||| | ||||||||||||||||| |||| ||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
40892910 |
aaacctgtataagatgttgggatctttgggtaggttcagcattgggcttggtgggtgcttccctgaaacaac |
40892839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University