View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13492_high_11 (Length: 308)
Name: NF13492_high_11
Description: NF13492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13492_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 30501892 - 30501692
Alignment:
| Q |
18 |
ataacattaattatcgttttcaattcagttaggttatgccatccatattagagacatttcaaatctcactctacctactagtg----------------- |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30501892 |
ataacattaattatcgttttcaattcagttaggttatgccatccatattagagacatttcaaatctcactctacctactagtgaatgtccattgaatgaa |
30501793 |
T |
 |
| Q |
101 |
-----tactaactccgtctctacatatacataattcatttgactacattagttgaataaagaaagttgatttgtcctctcaaaaatgaagttgatttgta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30501792 |
tggtatactaactccgtctctacatatacataattcatttgactacattagttgaataaagaaagttgatttgtcctctcaaaaatgaagttgatttgta |
30501693 |
T |
 |
| Q |
196 |
g |
196 |
Q |
| |
|
| |
|
|
| T |
30501692 |
g |
30501692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 255 - 293
Target Start/End: Complemental strand, 30501634 - 30501596
Alignment:
| Q |
255 |
gaaccccttaattatacctttagatcattttttagaggt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30501634 |
gaaccccttaattatacctttagatcattttttagaggt |
30501596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University