View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13492_high_5 (Length: 503)
Name: NF13492_high_5
Description: NF13492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13492_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 474; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 474; E-Value: 0
Query Start/End: Original strand, 1 - 486
Target Start/End: Original strand, 32741900 - 32742385
Alignment:
| Q |
1 |
tgttcatattcgtagccacattcagcggcacgaataaagtaaacggagtcccaaatgatgccgttttcgatggcggaagctatgggtgaacggtgagttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32741900 |
tgttcatattcgtagccacattcagcggcacgaataaagtaaacggagtcccaaatgatgccgttttcgatggaggaagctatgggtgaacggtgagttt |
32741999 |
T |
 |
| Q |
101 |
cgtttggagtggtggtggtggtggcggtgaggcaaggtgggtttagggatgcggaagtgtcgtaaggggaagctaggattcggaagaagatgattagggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742000 |
cgtttggagtggtggtggtggtggcggtgaggcaaggtgggtttagggatgcggaagtgtcgtaaggggaagctaggattcggaagaagatgattagggt |
32742099 |
T |
 |
| Q |
201 |
gattagaagaattcttgaatatattgctgattttagtactaatggttcgtgatgatcaaggtttgatttcgtctgaaacattttggattcggatttgatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742100 |
gattagaagaattcttgaatatattgctgattttagtactaatggttcgtgatgatcaaggtttgatttcgtctgaaacattttggattcggatttgatt |
32742199 |
T |
 |
| Q |
301 |
tcgatttcgtgagaatcatccacttcgctgcagtttcatcttttcaaagcctcaattgatggtgttcaaattctctcaattttatgtcttgatatttcgg |
400 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32742200 |
tcgatttcgtgagaatcatccacttcactgcagtttcatcttttcaaagcctcaattgatggtgttcaaattctctcaattttatgtcttcatatttcgg |
32742299 |
T |
 |
| Q |
401 |
agcgtccgaatcgaacccgaccccttaccaactgagttattttgggatgatatatccgatactttatttttatttttggtcatttc |
486 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32742300 |
agcgtccgaatcgaacccgaccccttaccaactgagttattttgggatgatatatccgatactttatttttatttttggtcatttc |
32742385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University