View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13492_low_21 (Length: 246)
Name: NF13492_low_21
Description: NF13492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13492_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 2 - 235
Target Start/End: Original strand, 48576438 - 48576671
Alignment:
| Q |
2 |
tccgggtagtattgaggaaatgaatctaatcaacatttgtcttatcgtaaaggtgagcaaacatgaattttttatcaatgtcaacctatatccatttgta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48576438 |
tccgggtagtattgaggaaatgaatctaatcaacatttgtcttatcgtaaaggtgagcaaacatgaattttttatcaatgtcaacctatatccatttgta |
48576537 |
T |
 |
| Q |
102 |
aagcgaattataagattcttaccaagatgatggtcaatagacatagacccaagacttacattgctcaaatcacctctcatcaaaaaactggttttgaacg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48576538 |
aagcgaattataagattcttaccaagatgatggtcaatagacatagacccaagacttacattgctcaaatcacctctcataaaaaaactggttttgaacg |
48576637 |
T |
 |
| Q |
202 |
aggaggaatacaagtgagaatattgttatgaatt |
235 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
48576638 |
aggaggagtacaagtgagaatattgttatgaatt |
48576671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University