View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13494_high_4 (Length: 255)
Name: NF13494_high_4
Description: NF13494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13494_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 6808094 - 6807861
Alignment:
| Q |
18 |
atgaggaacgtttggttctcactgtgcactcactttaccccattaccatatat--ttaagtgatattacaagattatcattgcacggtttcatcttatct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6808094 |
atgaggaacgtttggttctcactgtgcactcactttaccccattaccatatatatttaagtgatattacaagattatcattgcacggtttcatcttatct |
6807995 |
T |
 |
| Q |
116 |
tattgatcaagtgcaatcttgtcccaaaagggattaaagcatgtttcattcattctccatcgtaacaaatacagactcgagttaaagaatctaattacct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6807994 |
tattgatcaagtgcaatcttgtcccaaaagggattaaagcatgtttcattcattctccatcgtaacaaatacagactcaagttaaagaatctaattacct |
6807895 |
T |
 |
| Q |
216 |
caccccacttatttgtcatgttggattcatctca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6807894 |
caccccacttatttgtcatgttggattcatctca |
6807861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University