View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13494_high_5 (Length: 250)
Name: NF13494_high_5
Description: NF13494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13494_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 8 - 154
Target Start/End: Original strand, 8218612 - 8218758
Alignment:
| Q |
8 |
cgaagaaaatagggcacgcaagaaatcaataggtagaaaaagaaaagagtctttggagtattgaactgcatggatcatcaaatcgtcttcttagcatatt |
107 |
Q |
| |
|
|||| ||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8218612 |
cgaaaaaattagggcgtgcaagaaatcaataaatagaaaaagaaaagagtctttggagtattgaactgcatggatcatcaaatcctcttcttagcatatt |
8218711 |
T |
|
| Q |
108 |
agaacatttttcgacaaaaaagaagaagcatattagaacgtaaaact |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8218712 |
agaacatttttcgacaaaaaagaagaagcatattagaacgtaaaact |
8218758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 216 - 250
Target Start/End: Original strand, 8218820 - 8218854
Alignment:
| Q |
216 |
gtaaagctagcacttcaacaggcccctccgaataa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8218820 |
gtaaagctagcacttcaacaggcccctccgaataa |
8218854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University