View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13494_high_7 (Length: 238)
Name: NF13494_high_7
Description: NF13494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13494_high_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 2947190 - 2946970
Alignment:
| Q |
18 |
caatcatggtgtgtcccccagctgtacatttaaaccctgcgaaatatcaggatcctcttgtcttcaacccatctagatgggaggtgcgtttagcattttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2947190 |
caatcatggtgtgtcccccagctgtacatttaaaccctgcgaaatatcaggatcctcttgtcttcaacccatctagatgggaggtgcgtttagcattttt |
2947091 |
T |
 |
| Q |
118 |
tctctctcattttctttccatcttttcaaagctagttgcttcaaagaatctcaaaaagtaatgtagttagcttctttagcaagtactataaataaacatt |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2947090 |
tttctctcattttctttccatcttttcaaagttagttgcttcaaagaatctcaaaaagtaatgtagttagcttctttagcaagtactataaataaacatt |
2946991 |
T |
 |
| Q |
218 |
caagtaacttagatgctagtc |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2946990 |
taagtaacttagatgctagtc |
2946970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University