View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13494_low_3 (Length: 351)
Name: NF13494_low_3
Description: NF13494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13494_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 11 - 176
Target Start/End: Original strand, 16778959 - 16779125
Alignment:
| Q |
11 |
gaagcaaaggcaaatggaatgagaaacatgcagatcaggaaaagacaaaacaaattcaccactattgttggagcgaccacatgttccgcagctaaaccta |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
16778959 |
gaagcaaaggcaaatggaatgagagacatgcagatcaggaaaagacaaaacaaattcaccactattgtggaagcgaccacatgttccgcagctaaaccta |
16779058 |
T |
|
| Q |
111 |
-cccatcatgtgccttgtgtcagatgcaatgttgtgctgtttctgcttccttcctgcatgaattttt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16779059 |
ccccatcatgtgccttgtgtcagatgcaatgttgtgctgtttctgcttccttcctgcatgacttttt |
16779125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 246 - 333
Target Start/End: Original strand, 16779199 - 16779286
Alignment:
| Q |
246 |
tttaaggaggagtccaataatgaaagacaaaagcatattaaaaagtttggtcgatgtcattttttataggaccaatatttggtgaatc |
333 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16779199 |
tttaaggaggactccaaaaatgaaagacaaaagcatattaaaaagtttggtcgatgtcattttttataggaccaatatttggtgaatc |
16779286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University