View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13495_high_14 (Length: 356)
Name: NF13495_high_14
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13495_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 340
Target Start/End: Complemental strand, 30621235 - 30620913
Alignment:
| Q |
18 |
gttaggtttctctctatctccacaagaacaacatccatcaacacaagatcaaacggtggcttctcgttttgggttcaaccctaatgaaatctcaggttct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30621235 |
gttaggtttctctctatctccacaagaacaacatccatcaacacaagatcaaacggtggcttcccgttttgggttcaaccctaatgaaatctcaggctct |
30621136 |
T |
|
| Q |
118 |
gatgttcaaggagatcactgctatgatctctcttctcacacaactcctcatcattcactcaacctttctcatcctttttccatttatgaagctttccaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30621135 |
gatgttcaaggagatcactgctatgatctctcttctcacacaactcctcatcattcactcaacctttctcatcctttttccatttatgaagctttccaca |
30621036 |
T |
|
| Q |
218 |
caaataacaacattcacaccactcaaggtttcacttctttcaccaataactcttccctaattaattttgtcaagaaaaaattagtataaggcttcacctt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30621035 |
caaataacaacattcacaccactcaaggtttcacttctttcaccaataactcgtccctaattaattttgtcaagaaaaaattagtataatgcttcacctt |
30620936 |
T |
|
| Q |
318 |
ggttagcactttatgagaaatat |
340 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30620935 |
ggttagcactttatgagaaatat |
30620913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University