View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13495_high_19 (Length: 248)
Name: NF13495_high_19
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13495_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 39723661 - 39723880
Alignment:
| Q |
11 |
cacagacactaggtagaactaaacctgagagctttgagatataagctttccccaggcagcaggcttagctatcagtttggccacagaacgtggttttcgc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39723661 |
cacagacactaggtagaactaaacctgagagctttgagatataagctttccccaagcagcaggcttagctatcagtttggccacagaacgtggttttcgc |
39723760 |
T |
 |
| Q |
111 |
cgagaagaaaccaccggggcagccacttttggtttctcagcagattcaccttatccaatcaacaaaattcataaatctcagaaattaaaaaacacatgca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39723761 |
cgagaagaaaccaccggggcagccacttttggtttctcagcagattcaccttatccaatcaacaaaattcataaatctcagaaattaaaaaacacatgca |
39723860 |
T |
 |
| Q |
211 |
tgcataaaacagagacaact |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39723861 |
tgcataaaacagagacaact |
39723880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University