View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13495_high_21 (Length: 239)
Name: NF13495_high_21
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13495_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 45688665 - 45688462
Alignment:
| Q |
17 |
aatatggaggggtaggtctacttcaacgtaattttgtgtcgtattttgttgaagccgtctggttttctgataatataatgtagtgatgtcttattcaggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45688665 |
aatatggaggggtaggtctacttcaacgtaattttgtgtcgtattttgttgaagccgtctggttttctgataatataatgtagtgatgtcttattcaggt |
45688566 |
T |
 |
| Q |
117 |
taaaggcttatcaggttttctaaagtcagatttgaataaagggattagtggagatgacgatgatctatcaaagaggaaaaatgcatttggaactaataca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45688565 |
taaaggcttatcaggttttctaaagtcagatttgaataaagggattagtggagatgacgatgatctatcaaagaggaaaaatgcatttggaactaataca |
45688466 |
T |
 |
| Q |
217 |
tatc |
220 |
Q |
| |
|
|||| |
|
|
| T |
45688465 |
tatc |
45688462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 152 - 220
Target Start/End: Original strand, 1437826 - 1437894
Alignment:
| Q |
152 |
ataaagggattagtggagatgacgatgatctatcaaagaggaaaaatgcatttggaactaatacatatc |
220 |
Q |
| |
|
||||||| |||||||||||||| | |||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
1437826 |
ataaaggaattagtggagatgatgctgatctattgaaaaggaaaaatgcatttggaactaatacatatc |
1437894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University