View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13495_high_23 (Length: 234)

Name: NF13495_high_23
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13495_high_23
NF13495_high_23
[»] chr3 (1 HSPs)
chr3 (18-223)||(33136861-33137066)
[»] chr5 (2 HSPs)
chr5 (173-223)||(25258612-25258662)
chr5 (173-223)||(25322402-25322452)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 33137066 - 33136861
Alignment:
18 ggatcaatggtgggccagggatgttgttacatgaatttagaagatcaaaggttgttatagaagatcttagaggtgaaatggagagaaaaggatcaatgat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
33137066 ggatcaatggtgggccagggatgttgttacatgaatttagaagatcaaaagttgttatagaagatcttagaggtgaaatggagagaaaaggatcaatgat 33136967  T
118 ggaatgggaaaatgaagttgctattagagaaagagttgataatttgagaagctcttttggtgttcttagatctggtgctgataatattattgctcaactt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33136966 ggaatgggaaaatgaagttgctattagagaaagagttgataatttgagaagctcttttggtgttcttagatctggtgctgataatattattgctcaactt 33136867  T
218 gatgat 223  Q
    ||||||    
33136866 gatgat 33136861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 25258662 - 25258612
Alignment:
173 tttggtgttcttagatctggtgctgataatattattgctcaacttgatgat 223  Q
    |||||||| |||| ||||||||||||||||||| || |||| |||||||||    
25258662 tttggtgtgcttaaatctggtgctgataatattgtttctcagcttgatgat 25258612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 25322452 - 25322402
Alignment:
173 tttggtgttcttagatctggtgctgataatattattgctcaacttgatgat 223  Q
    |||||||| |||| ||||||||||||||||||| || |||| |||||||||    
25322452 tttggtgtgcttaaatctggtgctgataatattgtttctcagcttgatgat 25322402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University