View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13495_high_26 (Length: 203)
Name: NF13495_high_26
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13495_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 36724343 - 36724515
Alignment:
| Q |
12 |
gaagaaaatcaataacaataacaacatcaataagaagcatggagataacactgatgttgcaaaaacttctgctgacaagaaatttaaaactctgccacca |
111 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36724343 |
gaagaatatcaacaacaataacaacatcaacaagaaacatggagataacactgatgttgcaaaaacttctgctgacaagaaattcaaaactctgccaccg |
36724442 |
T |
|
| Q |
112 |
tctgagtccttacctaggaatgaaaccattggtggctatatatttgtttgcaacaatgataccatggcagaaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36724443 |
tctgagtccttacctaggaatgaaaccattggtggctatatctttgtttgcaacaatgataccatggcagaaa |
36724515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 80 - 179
Target Start/End: Complemental strand, 42173068 - 42172969
Alignment:
| Q |
80 |
ctgctgacaagaaatttaaaactctgccaccatctgagtccttacctaggaatgaaaccattggtggctatatatttgtttgcaacaatgataccatggc |
179 |
Q |
| |
|
|||||||||||| ||| || ||| | |||||| | ||||| | ||||||||||||||||||||||| ||||| ||||| || ||||||||||||||||| |
|
|
| T |
42173068 |
ctgctgacaagagattcaagactttaccaccagcagagtctcttcctaggaatgaaaccattggtgggtatatctttgtctgtaacaatgataccatggc |
42172969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University