View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13495_low_23 (Length: 247)
Name: NF13495_low_23
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13495_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 20595979 - 20595742
Alignment:
| Q |
10 |
catcatcaaacacaggttcagtcacagtatgttctactctttttcctcttggtcttcccctctttttctttggcttactaccactggccactgcagtcac |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20595979 |
catcatcaaacacaggttcaatcacagtatgttctactctttttcctcttggtcttcccctctttttctttggcttactaccactagccactgcagtcac |
20595880 |
T |
 |
| Q |
110 |
actaggttctgtctgagttccttcagatgcaacttcctgagtcacattctgatctgcttcaacatctccctgtattgcttcttcattaacaacattccca |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20595879 |
actaggttctgtctgagtttcttcagatgcaacttcctgagtcacattctgatctgcttcaacatctccctgtattgcttcttcattaacaacattccca |
20595780 |
T |
 |
| Q |
210 |
acattcccctcaccttcaaaaatatcactaactacctc |
247 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20595779 |
atattcccctcaccttcaaaaatgtcactaactacctc |
20595742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 8696978 - 8696744
Alignment:
| Q |
10 |
catcatcaaacacaggttcagtcacagtatgttctactctttttcctcttggtcttcccctctttttctttggcttactaccactggccactgcagtcac |
109 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || ||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8696978 |
catcatcaaacacaggttcagtcacaatatattgtactcttgatcctcttggtcttcccctccttttctttggcttactaccactggcctctgcagtcac |
8696879 |
T |
 |
| Q |
110 |
actaggttctgtctgagttccttcagatgcaacttcctgagtcacattctgatctgcttcaacatctccctgtattgcttcttcattaacaacattccca |
209 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8696878 |
actaggttctatctgaattccttgagatgcagcttcctgagtcacattatgatctgcttcaacatctccctgtattgcttcttcattaacaacattccca |
8696779 |
T |
 |
| Q |
210 |
acattcccctcaccttcaaaaatatcactaactac |
244 |
Q |
| |
|
||||||| |||| | |||||||| ||||||||||| |
|
|
| T |
8696778 |
acattcctctcaacatcaaaaatgtcactaactac |
8696744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University