View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13495_low_26 (Length: 234)
Name: NF13495_low_26
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13495_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 33137066 - 33136861
Alignment:
| Q |
18 |
ggatcaatggtgggccagggatgttgttacatgaatttagaagatcaaaggttgttatagaagatcttagaggtgaaatggagagaaaaggatcaatgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33137066 |
ggatcaatggtgggccagggatgttgttacatgaatttagaagatcaaaagttgttatagaagatcttagaggtgaaatggagagaaaaggatcaatgat |
33136967 |
T |
 |
| Q |
118 |
ggaatgggaaaatgaagttgctattagagaaagagttgataatttgagaagctcttttggtgttcttagatctggtgctgataatattattgctcaactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33136966 |
ggaatgggaaaatgaagttgctattagagaaagagttgataatttgagaagctcttttggtgttcttagatctggtgctgataatattattgctcaactt |
33136867 |
T |
 |
| Q |
218 |
gatgat |
223 |
Q |
| |
|
|||||| |
|
|
| T |
33136866 |
gatgat |
33136861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 25258662 - 25258612
Alignment:
| Q |
173 |
tttggtgttcttagatctggtgctgataatattattgctcaacttgatgat |
223 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
25258662 |
tttggtgtgcttaaatctggtgctgataatattgtttctcagcttgatgat |
25258612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Complemental strand, 25322452 - 25322402
Alignment:
| Q |
173 |
tttggtgttcttagatctggtgctgataatattattgctcaacttgatgat |
223 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| || |||| ||||||||| |
|
|
| T |
25322452 |
tttggtgtgcttaaatctggtgctgataatattgtttctcagcttgatgat |
25322402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University